Saturday, March 25, 2006

THE MIRROR TALKS ON MELANCHOLY


Melancholy μελας, melas, "black", + χολη, kholé, "bile"










The black bile (bilis negra) was one of the four humors in ancient and medieval psychology ( found in Hippocates also) and is identified as the ruling flow of the alchemist -under the sign of Saturn, guardian of the days, the enduring spite of time. So we could say Paracelsus had it, Agrippa had its, (Lou Reed had it? but lost it?) and of course Trimegistus, the Great Architect of the Pyramids and Lord of the Arcanes, he had to have it. BUT DO YOU HAVE IT? not to be confused with sadness, depression, lovelessness, fear but oh sometimes so confused with blue light sword in the heart have you ever said its so painfully beautiful or vampire transparence or felt the radiant magnetism of the abyss the charming chasm or kiss the devil pale moonlight or sunday morning cutting cute sunblade
like the song from the donnie darko album " the dreams in which iam dying are the best i ever had.. i find it kind hard to tell u i find it hard to take" the absence of otherness raw and magnified ....


HEY HAPPPY BIRTHDAY HAPPY BIRTHDAY

nervous nervous boy

but the alchemist transcends all of this for ge wants to end the buddha everwheel of suffering he says elixir:exit
on this planet says Burroughs we are here to go earthspaceship weave the dream out of the web (is this anatheme)
melancholy so is the acute consciousness of the overflow of existence and its cool synthesis through the great work OPUS MAGNUM that designs through ethereal discipline mirrorcrossing and willpower a way out wich is in itself a way in, into the GREAT RIVER: Linfa Mundis: Menstrum Universalis divingintothedivinemother vortexwomb the alchemist like the common melancholical stares from the top of the building to the bottom of the street but unlike the melancholical who thinks of jumping to kill himself, to fall, to forget, the alchemist TAKES THE GREAT LEAP but in an exact paradox opposit he jumps to finally live in unillussion, to ascend to the higher realms or sephirots of awareness, to remember all of his past existence, to enter akash's free bar, to BE IN FLIGHT ALL OF EXISTENCE in one ever-expanding moment of joint experience he percieves like the angelmonster of infinite heads so he is breath of the logosbreath birth and bird he frolics in the holocean of the primal source dolphins sex highway dolphins fuck crows for fun HE ASKS YOU NOW CAN YOU SWIM IN THE AIR FLY IN THE GROUND DIVE IN THE SKY ? knows that there is no death but the mind, the mind and time hey Hermes, Father Of Surf, let me not be sad and hit the waves uterrly unafraid
blue crush and swell this is the prayer the melancholical in the mirror says to himself I Orpheus the Other will not look back
having said the ineffable and seen the invisible my portals will be ahead and will be through the aurea floresta
my surfboard will be the Stone my lightbeam will be my thoughts which will never fail to contemplate the one goal:
to leave this world so i (becoming we) can live on this world as it is "when the doors of perception are cleansed the world appears as it is: infinite"
............................................................................................................................................................................

SOME SONGS ON MELANCHOLY OR VAGUELY

"Mad World" by Gray Jules from the Donnie Darko Album

"Under the Milkyway Tonight" from the Donnie Darko Album

"Falling" Julee Cruise from the Twin Peaks Album

"Fade into You" Mazzy Star Among My Swan Album

"Born Slippy" Underworld (postchemical transexy melancholy kissing the moonboy)

"Pale Blue Eyes" Velvet Underground

"It Could Have Been A Brilliant Career" Belle and Sebastian

"Half a Person

The Seventh Song on the Beatles White Album "nobody told you how to unfold your love..."

"By This River" Brian Eno Before and After Science Album (which depicts the lyrical melancholy of being born again into this world and forgetting, perhaps attached to the other, to the greatest illusion: love , the song goes "Here we are stuck by this river u and i underneath a sky thats ever falling ..." to which one could awnser in Moises Couduros words " In Stars we remember in Planets we forget", from the Platonic Astral Metempsicosis

"People are Strange" by The DOORS

"Melancholy and the Indefinite Sadness" Album by the Smashing Pumpkins

"Scary World Theory" Lali Puna (but the cocaine monster beside your bed)

All of Slowdive's discography particulary:

"Souvlaki" produced by Brian Eno

for Gothic cholios 4.A.D Records

..............................................................

LITERARY WORKS

"The Merchant of Venice" by William Trimegistus Shakespeare on which Portia the Lady of Belmont (isnt that a lovely name Belmont) leads the way to the gold of her heart to the one true chevelier who can decypher the alchemical riddle that defeats illusions, being , as the alchemical sayng goes, Saturn the Guardian of the Door of Gold, lead (plomo) the way the supern choice, the metal of Saturn. Sacred Heart of The Lady of Belmont

Trisstesa by Jack Kerouak Mexican Princess of Heroin a very melancholical opiate

Ode on Melancholy by John Keats the most melancholical poet of the all dying at 26 from tuberculosis

"She dwells with Beauty -- Beauty that must die;
And Joy, whose hand is ever at his lips
Bidding adieu; and aching Pleasure nigh,
Turning to poison while the bee-mouth sips:
Ay, in the very temple of Delight
Veil'd Melancholy has her sovran shrine..."

La Conjura de los Necios de Kennedy O'Toole

Death in Venice by Thomas Mann

"A la Recherche du Temps Perdu" Marcel Proust

"The Raven" Edgar Allan Poe (who was born under Saturn)

"De la Melancolia" Freud donde supone que la melancolia es un deseo de confesion

Albert Camus "The only question worth asking is should i kill myself?

the alchemical image goes " The melancholy, introverted Moon Queen holds the reins to a great fish, symbolizing her control of thos esame hidden froces that threaten the King, and behind her is a chaff of wheat, which stands for her connection to fertility and growth. The bow and arrow she cradles in her left arm sybmolize the wounds of the heart and body she accepts as part of her existence". Dennis William Hauck interprets The Emerald Tablet

PAINTINGS

"MELANCHOLY" by Albert Durer (the foremost work on the subject from the Mystic School)

................................

AND SO , HOW DOES IT FEEL?
0 talk to the riveron

Thursday, March 23, 2006

question from riveron lands

What do you want to be?
0 talk to the riveron

Friday, March 17, 2006

Emerald Tablet


1) It is true without untruth, certain and most true.

2) That which is below is like that which is on high, and that which is on high is like that which is below; by these things are made the miracles of one thing.

3) And as all things are, and come from One, by the mediation of One, So all things are born from this unique thing by adaptation.

4) The Sun is the father and the Moon the mother.

5) The wind carries it in its stomach. The earth is its nourisher and its receptacle.

6) The Father of all the Theleme of the universal world is here.
6a) Its force, or power, remains entire

7) if it is converted into Earth.
7a) You separate the Earth from the fire, the subtle from the gross, gently with great industry.

8) It climbs from the Earth and descends from the sky, and receives the force of things superior and things inferior.

9) You will have by this way, the glory of the world and all obscurity will flee from you.

10) It is the power strong with all power, for it will defeat every subtle thing and penetrate every solid thing 11a) In this way the world was created.

11) From it are born wonderful adaptations, of which the way here is given.

12) That is why I have been called Hermes Tristmegistus, having the three parts of the universal philosophy.

13) This, that I have called the solar Work, is complete.

Fulcanelli 1964: 312.
0 talk to the riveron

Human Genome: First 13 lines of Chromosome 1



GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTGA
TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTGTGCTTCTA
TCTAGAAGGTAGAGCTGTGGTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCAT
GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAG
CTAGAAGAAAAGCATTGGGAAGTTTCCAACATGAAGAAAAGATAAATGGTCAAGGGAATG
GATATCCTAATTACCCTGATTTGATCATTATGCATTATATACATGAATCAAAATATCACA
CATACCTTCAAACTATGTACAAATATTATATACCAATAAAAAATCATCATCATCATCTCC
ATCATCACCACCCTCCTCCTCATCACCACCAGCATCACCACCATCATCACCACCACCATC
ATCACCACCACCACTGCCATCATCATCACCACCACTGTGCCATCATCATCACCACCACTG
TCATTATCACCACCACCATCATCACCAACACCACTGCCATCGTCATCACCACCACTGTCA
TTATCACCACCACCATCACCAACATCACCACCACCATTATCACCACCATCAACACCACCA
CCCCCATCATCATCATCACTACTACCATCATTACCAGCACCACCACCACTATCACCACCA
CCACCACAATCACCATCACCACTATCATCAACATCATCACTACCACCATCACCAACACCA
0 talk to the riveron

Tuesday, March 07, 2006

wishful thinking for two friends

0 talk to the riveron

icelandice for the eyes (bon voyage diego, -iceye-)

0 talk to the riveron

Monday, March 06, 2006

river on lyric -(-(- "by this river"

by this river

brian eno

Here we are
Stuck by this river,
You and I
Underneath a sky that's ever falling down, down, down
Ever falling down.

Through the day
As if on an ocean
Waiting here,
Always failing to remember why we came, came, came:
I wonder why we came.

You talk to me
as if from a distance
And I reply
With impressions chosen from another time, time, time,
From another time.

...

0 talk to the riveron

Wednesday, March 01, 2006

ash mercury, black cross (whipped whisper)

Mystical greetings from riveron to hoy holy miércoles de ceniza
Pretty tattoos for everyone
(Wednesday windy ashes for reflection)
long live crystal dust
long live spirit...


en miércoles de ceniza
0 talk to the riveron



Full Moon
100% of Full
Sat 12 Apr, 2025moon phases
Creative Commons License
This work is licensed under a Creative Commons License.